| Home | E-Submission | Sitemap | Editorial Office |  
top_img
Korean J. Pl. Taxon > Volume 48(2); 2018 > Article
CHO, HAN, KWAK, and LEE: New polymorphic microsatellite markers for the endangered fern Ceratopteris thalictroides (Parkeriaceae)

Abstract

Ceratopteris thalictroides is a semi-aquatic fern with a circumtropical distribution. Because this species is designated internationally on the IUCN Red List as requiring at least some concern, Korean populations are of great concern for the species’ long-term survival, as they are at the northern limit of the species distribution. To establish an effective conservation strategy for those populations at the genetic level, we used the Mi-Seq platform to develop three sets of 25 polymorphic microsatellite markers for C. thalictroides, which is endangered in Korea. In populations sampled from Busan and Gochang, the number of alleles ranged from 2 to 13 (average of 5.64), and plants presented an expected heterozygosity of 0.000 to 0.860. These markers will be useful for evaluating the genetic status and conserving Korean populations of C. thalictroides more effectively.

Ceratopteris thalictroides (L.) Brongn. (Parkeriaceae) is a semi-aquatic fern with circum-tropical distribution, mainly growing in paddy fields, ponds, or marshes (Watano and Masuyama, 1994). This genus contains four species (Lloyd, 1974). Whereas three of those species are diploid plants, C. thalictroides is tetraploid (Hickok, 1977; Masuyama and Watano, 2005). Although C. thalictroides is widely distributed throughout tropical and subtropical regions, it is internationally considered to be of as least some concern, based on the IUCN Red List of Threatened Species.
In Korea, this species was first recorded at Suncheon and Gwangyang, in the southern regions of the Peninsula. Since then, more populations have been identified. This species is now designated as endangered in Korea and has been assigned legal protection for eight extant populations (Seocheon, Gunsan, Jeongeup, Buan, Iksan, Gochang, Gwangju, and Busan). These Korean populations are clearly critical because they represent the northern edge of the distribution range, possibly providing potential for further expansion of the species if those plants are able to adapt to selection pressures from such marginal environments (Kawecki, 2008). Therefore, efforts to conserve Korean populations are needed if we are to achieve long-term survival for C. thalictroides.
In China, researchers are also taking various steps to conserve the populations of C. thalictroides. There, this species has been designated as endangered in an effort to protect and manage its native habitats (Yu, 1999). In addition, its genetic variability has been analyzed by using various markers such as random amplified polymorphic DNA, inter-simple sequence repeat, and microsatellites (Dong et al., 2008; Yang et al., 2016). Although 30 microsatellite markers have been established for Chinese populations of C. thalictroides (Yang et al., 2016), they are not adequate for frequently examining genetic polymorphism. Furthermore, it is cost-effective for such markers to be organized as “sets” if researchers are to continue periodic genetic monitoring. Therefore, we have developed new polymorphic microsatellite sets for evaluating the genetic status of Korean populations of C. thalictroides and conserving those plants.

Materials and Methods

For these new microsatellite markers, total genomic DNA was obtained from a fresh leaf collected from an individual plant of C. thalictroides growing at the Dongnim reservoir, Gochang, Korea. The extraction procedure involved an MG Plant Genomic DNA Extraction SV Miniprep Kit used according to the manufacturer’s protocol (Macrogene Inc., Seongnam, Korea). After the quality of the genomic DNA was checked by gel electrolysis, we generated a shotgun library by using the Illumina Mi-Seq platform (LAS, Seoul, Korea). In all, 5,256,220 paired-ends with read lengths of approximately 300 bp were obtained. Based on screening with the SSR_Pipeline v.0951 infrastructure (Miller et al., 2013), we identified a 22,990 microsatellite motif with flanking regions larger than 100 bp that contained di-, tri-, or tetra-nucleotide repeats that were at least 12, 6, or 5 times, respectively, in size. Following the method of Cho et al. (2015), we assembled groupings of 50 to 100 reads that were reference guide-mapped on the whole raw reads, using the Geneious R10.1.3 software platform (Kearse et al., 2012). From this, we selected reads that had two separate alleles and no additional single nucleotide polymorphisms in the flanking region. After eliminating any duplication through de novo assembly, we used the final chosen reads to develop microsatellite markers. We then utilized the Primer 3 software in Geneious program R10.1.3 to design 81 primer pairs (18–22 bp long), using a melting temperature of 53–60°C and GC contents of 35–65%. The forward primers added three sets of M13 tag sequences (5′-CACGACGTTGTAAACGAC-3′, 5′-TGTGGAATT GTGAGCGG-3′, and 5′-CTATAGGGCACGCGTGGT-3′) with 6-FAM, VIC, and NED fluorescent dye, respectively. For multiplex polymerase chain reaction (PCR), each primer set comprised nine primers with lengths of 100–300 bp.
To test the effectiveness of these new microsatellite loci, we sampled 63 individuals of C. thalictroides from two populations (Dongnim reservoir, Gochang, n = 33; Is. Doonchido, Busan, n = 30). For each locus, PCR amplification was performed in a final volume of 5 μL that contained 15 to 20 ng of extracted DNA, 2.5 μL of 2× Multiplex PCR master mix (Qiagen, Valencia, CA, USA), 0.01 μM for the forward primer, 0.2 μM for the reverse primer, and 0.1 μM for the M13 primer. The PCR protocol included an initial denaturation for 15 min at 95°C; followed by 30 cycles, each consisting of denaturing for 30 s at 94°C, 1.5 min of annealing at 52°C, and extension for 1.5 min at 72°C; with a final extension for 10 min at 72°C. The PCR products were analyzed using an ABI 3730XL sequencer with GeneScan-500LIZ Size Standard (Applied Biosystems, Foster City, CA, USA). Allele sizes and the peaks of each sample were determined via Peak Scanner software 2 (Applied Biosystems). In analyzing the tetraploid microsatellite data, we were not able to make exact determinations of allele frequencies and patterns due to the uncertainty of multiple alleles (Dufresne et al., 2014). Therefore, we calculated the number of alleles (N A), the Shannon-Wiener Diversity Index (H′), and the expected heterozygosity (H E) using Atetra 1.2 software (van Puyvelde et al., 2010), which was developed for analyzing codominant microsatellite data in tetraploid species.

Results and Discussion

We have produced useful sets of microsatellite markers for analyzing genetic diversity and establishing conservation strategies for Ceratopteris thalictroides, an endangered plant. Of the 81 primer pairs studied here, 25 microsatellite markers were polymorphic, and 17 were found to be monomorphic in two of the examined populations (Table 1). All developed markers have been deposited in GenBank (Table 1). Among the 25 polymorphic microsatellite loci, the number of alleles per locus ranged from 2 to 13, with an average of 5.64. Values for (H E) were 0.000 to 0.860, while H′ ranged from 0.000 to 2.152 (Table 2). These results are similar to those reported from a previous study in China (Yang et al., 2016) that involved RAD tag sequencing (N A, 4–10; H E, 0.264–0.852). However, because the Korean Peninsula is a northern limit for the distribution of C. thalictroides, our findings suggest that the marker sets described here include considerable polymorphism.

Acknowledgments

This work was supported by the National Institute of Biological Resources of Korea (Grant No. NIBR201703101).

NOTES

Conflict of Interest
Authors declare that there is no conflict of interest.

Table 1.
Characterization of 25 microsatellite loci for Ceratopteris thalictroides.
Locus a Primer sequence (5′–3′) Repeat motif N A Allele size range (bp) Fluorescent label GenBank accession No.
Multiplex mix A
cet007 F: AAAATACTGGCCACGGTTG
R: AAGATGTTGAAGTGGGCTG
(AG)17 8 153–179 NED MH261329
cet009 F: TGAATTGCTCATGATGTTGC
R: AGACTCGTTTTCATGGAGAC
(GAA)7 3 232–241 NED MH261330
cet017 F: CAAGAGGAGGCAGAATAACA
R: TCTCTCTCCTAGGTTTCAAGT
(AAG)16 5 210–222 NED MH261333
cet023 F: CCTCACTCTCTTTCCAAACT
R: CATTCCGATACACCAAGCTA
(CTC)7 5 180–207 VIC MH261337
cet028* F: ACATGCTTCTTTGATCTCGT
R: TATGATCTTTGATGCAGGCA
(AG)12 4 179–189 6-FAM MH261339
cet101 F: ACTTTTGAACTATTCTGCATCG
R: TTGTTGTACATTTGTTGGCT
(AC)13 2 98–102 6-FAM MH261347
cet104 F: TGCCATACCAAATGTCAAGA
R: CATTACACTATGCACATGGA
(TACA)5 2 139–151 VIC MH261348
cet120 F: GTCAGAATCCCGTCAGTATC
R: CAACAAGAGGGACAGCTTAT
(GTAT)9 5 222–238 6-FAM MH261352

Multiplex mix B
cet010* F: TAAAAGCGATCTCCACGTAG
R: TAAAGCTTGGAGAGAGGCTA
(AG)16 9 143–165 6-FAM MH261331
cet012* F: AGTCAAAACTCTGTGCTAGG
R: TACGTTGGCTATGTTCCTTC
(AG)13 5 227–241 6-FAM MH261332
cet018* F: CAGGATAGAGAGGATTTCGC
R: AGGAGGAGCATTCTATGACT
(TC)24 7 242–254 NED MH261334
cet022 F: TCATATCGCAATCAAAGCAG
R: TGGAAGAGAGAGAGCAATTG
(TC)17 7 177–189 VIC MH261336
cet025 F: GGAGAGAAATGCTTGTATTGT
R: ATGACGATCATGAATGGGTG
(TG)12 8 175–189 NED MH261338
cet042* F: GAAGACATCACCTCCTCTG
R: CAAGAAAGAGCAAGGAGTCT
(GA)13 3 267–271 VIC MH261342
cet046 F: GACACCATTCCATGCGAC
R: ATACTTGCGTGTGTGAGAG
(CT)12 3 185–189 6-FAM MH261343
cet050 F: CAATGAGCAGAGTTGTGAAG
R: TCATGGTTGTTTTGGAGGAA
(CT)17 9 209–233 VIC MH261344
cet108 F: CCATCATTTGAGTCGAGGAT
R: ACAGAGTTGCACAAGGTATT
(TG)12 5 161–171 NED MH261350

Multiplex mix C
cet021* F: GCAACAACTAAAGCGTCAAT
R: TGGTCACTGACGAATCAAAT
(AC)16 6 240–254 6-FAM MH261335
cet029* F: TACAGTGACAATGCTTTCCT
R: CTCTGAGCCTTCCTTTTCTT
(GAA)6 4 213–222 6-FAM MH261340
cet032* F: TTCTTCTTCAGGCACCTTTT
R: AGTTCTGAGAGTCCACAATG
(CAA)6 3 209–215 VIC MH261341
cet051 F: GACGATGGAGGCATTATGAT
R: GATAGGTTCTAGGCGCATTT
(GA)22 14 291–315 VIC MH261345
cet053 F: CTTGGGATGCGAGAAATAGT
R: CCATCCTCATCTTCACCAAA
(TC)15 7 226–242 NED MH261346
cet107 F: GGCCTCTGTGGAATATGATT
R: TTCATGTCCTAACTCAACCG
(TG)17 3 158–162 NED MH261349
cet113 F: GTCCCGACTTTAAATCCCAT
R: GCAAAATTGTTGGGCAGAC
(CA)15 4 169–187 VIC MH261351
cet127 F: TTGAACTTGGAGCATGAAAG
R: TGGCGAATATGACATACCTT
(CT)16 9 257–275 NED MH261353

N A, number of alleles.

a Reaction concentrations in PCR for primers were 0.01 for forward primer and 0.2 for reverse primer. Loci marked with asterisk (*) had reaction concentrations of 0.02 for forward primer and 0.4 for reverse primer.

Table 2.
Summary of genetic parameters estimated from 25 microsatellite loci across 63 individuals sampled from the two Korean populations, Gochang (GC) and Busan (BS), Korea.
GC (n = 33) BS (n = 30)

Locus N A H E H′ Sr N A H E H′ Sr
cet007 2 0.114 0.229 153–155 8 0.826 1.856 153–179
cet009 3 0.621 1.021 232–241 3 0.583 0.946 232–241
cet010 7 0.718 1.425 143–163 8 0.810 1.825 145–165
cet012 4 0.501 0.861 227–237 4 0.589 1.084 227–241
cet017 5 0.685 1.307 210–222 2 0.320 0.500 213–222
cet018 6 0.670 1.322 242–254 5 0.627 1.223 244–254
cet021 5 0.622 1.190 240–254 4 0.643 1.130 240–252
cet022 6 0.637 1.297 179–189 4 0.266 0.548 177–187
cet023 4 0.691 1.244 180–207 4 0.692 1.256 180–207
cet025 8 0.784 1.733 175–189 7 0.749 1.541 177–189
cet028 3 0.601 0.994 179–189 3 0.604 1.010 179–189
cet029 4 0.729 1.339 213–222 4 0.728 1.341 213–222
cet032 2 0.497 0.691 209–215 3 0.564 0.906 209–215
cet042 2 0.114 0.229 267–269 3 0.499 0.693 267–271
cet046 2 0.165 0.305 187–189 3 0.615 1.025 185–189
cet050 9 0.717 1.495 209–233 6 0.785 1.620 209–231
cet051 11 0.859 2.124 295–315 13 0.860 2.152 291–313
cet053 7 0.687 1.414 226–242 6 0.643 1.324 226–240
cet101 2 0.030 0.077 98–102 1 0.000 0.000 98
cet104 2 0.497 0.690 139–151 2 0.453 0.645 139–151
cet107 2 0.030 0.077 160–162 3 0.183 0.368 158–162
cet108 5 0.730 1.424 161–171 4 0.679 1.203 161–169
cet113 2 0.497 0.691 169–185 4 0.637 1.163 169–187
cet120 4 0.680 1.224 226–238 3 0.452 0.731 222–234
cet127 5 0.640 1.208 265–273 7 0.803 1.771 257–275

N A, number of alleles; H E, expected heterozygosity; H′, Shannon-Wiener Diversity Index; Sr, size range (bp).

Literature Cited

Cho, W-B. Choi, I-S and Choi, B-H. 2015. Development of microsatellite markers for the endangered Pedicularis ishidoyana (Orobanchaceae) using next-generation sequencing. Applications in Plant Sciences 3: 1500083.
crossref
Dong, Y-H. Chen, J-M. Robert, GW and Wang, Q-F. 2008. Genetic variation in the endangered aquatic fern Ceratopteris thalictroides (Parkeriaceae) in China: implications from RAPD and ISSR data.. Botanical Journal of the Linnean Society 157: 657-671.
crossref pdf
Dufresne, F. Stift, M. Vergilino, R and Mable, BK. 2014. Recent progress and challenges in population genetics of polyploid organisms: an overview of current state-of-the-art molecular and statistical tools. Molecular Ecology 23: 40-69.
crossref pmid
Hickok, LG. 1977. Cytological relationships between three diploid species of the ferns genus Ceratopteris . Canadian Journal of Botany 55: 1660-1667.
crossref
Kawecki, TJ. 2008. Adaptation to marginal habitats. Annual Review of Ecology, Evolution, and Systematics 39: 321-342.
crossref
Kearse, M. Moir, R. Wilson, A. Stones-Havas, S. Cheung, M. Sturrock, S. Buxton, S. Cooper, A. Markowitz, S. Duran, C. Thierer, T. Ashton, B. Meintjes, P and Drummond, A. 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647-1649.
crossref pmid pmc pdf
Lloyd, RM. 1974. Systematic of the genus Ceratopteris Brongn. (Parkeriaceae) II. Taxonomy. Brittonia 26: 139-160.
crossref
Masuyama, S and Watano, Y. 2005. Cryptic species in the fern Ceratopteris thalictroides (L.) Brongn. (Parkeriaceae). II. Cytological characteristics of three cryptic species. Acta Phytotaxonomica et Geobotanica 56: 231-240.

Miller, MP. Knaus, BJ. Mullins, TD and Haig, SM. 2013. SSR_pipeline: a bioinformatic infrastructure for identifying microsatellites from paired-end Illumina high-throughput DNA sequencing data.. Journal of Heredity 104: 881-885.
crossref pmid pdf
van Puyvelde, K. van Geert, A and Triest, L. 2010. ATETRA, a new software program to analyse tetraploid microsatellite data: comparison with TETRA and TETRASAT. Molecular Ecology Resources 10: 331-334.
crossref pmid
Watano, Y and Masuyama, S. 1994. Genetic differentiation in populations of the polymorphic fern Ceratopteris thalictroides in Japan. Journal of Plant Research 107: 139-146.
crossref
Yang, XY. Long, ZC. Gichira, AW. Guo, YH. Wang, QF and Chen, JM. 2016. Development of microsatellite markers in the tetraploid fern Ceratopteris thalictroides (Parkeriaceae) using RAD tag sequencing. Genetics and Molecular Research 15: gmr7550.

Yu, YF. 1999. A milestone of wild plant conservation in China. Plants 5: 3-11.

TOOLS
PDF Links  PDF Links
PubReader  PubReader
ePub Link  ePub Link
Full text via DOI  Full text via DOI
Download Citation  Download Citation
CrossRef TDM  CrossRef TDM
  E-Mail
  Print
Share:      
METRICS
0
Crossref
571
View
35
Download
Related article
Editorial Office
Korean Journal of Plant Taxonomy
Department of Life Sciences, Hallym University, Chuncheon 200-702, Korea
TEL: +82-33-248-2095   FAX: +82-33-256-3420    E-mail: kjpt1968@gmail.com
About |  Browse Articles |  Current Issue |  For Authors and Reviewers
Copyright © Korean Society of Plant Taxonomists. All rights reserved.