| Home | E-Submission | Sitemap | Editorial Office |  
top_img
Korean J. Pl. Taxon > Volume 46(2); 2016 > Article
Taquet 신부의 왕벚나무: 엽록체 염기서열을 통한 야생 왕벚나무와 재배 왕벚나무의 계통학적 비교

적 요

천주교 대구교구청에 심어져 있는 오래된 왕벚나무의 기원을 추적하기 위하여 제주도에 자생하는 야생 왕벚나무와 재배 왕벚나무(Somei-yoshino cherry)의 계통분류학적 유연관계를 알아보았다. 한국과 일본에서 채집한 야생 왕벚나무, 재배 왕벚나무 및 근연종인 올벚나무, 총 25 개체에 대하여 cpDNA 두 구간(rpl16 유전자, trnS-trnG intergenic spacer)의 염기서열을 사용하여 계통수와 반수체형(haplotype) 네트워크를 작성하여 두 분류군을 비교하였다. 야생 왕벚나무와 재배 왕벚나무는 서로 구별되는 분류군으로 드러났으며, 비록 적은 샘플을 대상으로 비교적 짧은 유전자위가 사용되었지만 야생 왕벚나무는 재배 왕벚나무보다 반수체형 다양성이 높은 것으로 나타났다. 이는 야생 왕벚나무의 교배 기원에 모계쪽으로 기여한 것으로 알려진 올벚나무의 유전적 다양성에서 기인하는 것으로 추정된다. 따라서, 야생 왕벚나무와 재배 왕벚나무의 계통분류학적 관계를 보다 명확하게 파악하기 위하여 올벚나무를 한국과 일본의 다양한 분포 지역에서 넓게 채집하여 추가 연구를 실시할 필요가 있다고 생각된다. Taquet 신부가 제주에서 채집하여 대구에 옮겨 심었다고 추정되었던 천주교 대구교구청의 오래된 왕벚나무는 야생 왕벚나무가 아닌 재배 왕벚나무로 보는 것이 타당하다.

Abstract

As an attempt to determine the identity of the old trees of flowering cherries planted in the yard of the Catholic Archdiocese of Daegu, we conducted comparative phylogenetic analyses between wild and cultivated Prunus yedoensis Matsum. We generated the phylogeny (MP) and haplotype network (TCS) of 25 individuals, including wild P. yedoensis, from Jeju Island, cultivated P. ×yedoensis ‘Somei-yoshino’ from Korea and Japan, and P. spachiana f. ascendens (Makino) Kitam. from Jeju Island and Japan based on highly informative sequences of two cpDNA regions (rpl16 gene and trnS-trnG intergenic spacer). The wild and cultivated P. yedoensis were distinguished from each other in both the phylogeny and haplotype networks, and the old flowering cherry trees in Daegu had a cpDNA haplotype identical to that of the cultivated P. ×yedoensis ‘Someiyoshino’. Compared to the cultivated P. ×yedoensis ‘Somei-yoshino’, wild P. yedoensis appears to have greater haplotype diversity, presumably originating from the genetic diversity of P. spachiana f. ascendens that functioned as a maternal parent in the hybrid origin of wild P. yedoensis. A future detailed study requires extensive sampling of P. spachiana f. ascendens from Japan and Korea to determine their precise phylogenetic relationships relative to wild and cultivated P. yedoensis. We concluded that the old flowering cherry trees planted in the yard of the Catholic Archdiocese of Daegu are highly likely to be of cultivated origin rather than wild types from Jeju Island, as previously speculated.

벚나무류는 장미과(Rosaceae)의 벚나무속(Prunus L.)의 Cerasus (Mill.) A. Gray 아속에 속하는 식물이다. Cerasus 아속의 식물들은 흰 색 가루가 없는 핵과의 열매, 동아 속에서 접혀있는 잎, 꽃자루가 있거나 없는 꽃들이 산형이나 산방화서를 이루는 형태학적 특징을 가지고 있다(Gray, 1856). 주로 북반구 온대지역에서 자라며 특히 중국에 33종이 분포하고 있으나(Yu and Li, 1986), 한국에서도 10여 종 이상이 숲 속의 야생 환경에서 발견되고 있다(Lee, 2003). 또한 벚나무류는 수많은 품종들이 개발되어 관상수 및 조경수로 식재되고 있는 경제적 가치가 매우 높은 분류군이다.
재배 벚나무 중에서 특히 일본 원산인 Somei-yoshino cherry (Prunus × yedoensis ‘Somei-yoshino’)는 가장 인기 있는 cultivar로서 한국과 일본 뿐 아니라 미국에서도 널리 식재되고 있다(Bailey and Bailey, 1976; Cheng et al., 2000). 일본의 Somei-yoshino cherry는 동경대 교수였던 Matsumura에 의하여 당시에 널리 식재되고 있던 재배품종을 기준으로 Prunus yedoensis Matsumura라는 학명으로 기재되었으나(Matsumura, 1901), 야생에서는 발견되지 않았다(Krüssmann, 1986). Somei-yoshino cherry의 기원에 관한 연구로는 형태학적 관찰(Wilson, 1916), 교배실험(Takenaka, 1963), 문헌조사(Iwasaki, 1991), DNA fingerprinting study (Innan et al., 1995), 분자계통학적 연구(Ohta et al., 2006; Nakamura et al., 2015) 및 집단유전학적 연구(Kato et al., 2014) 등이 이루어졌다. Prunus spachiana f. ascendens (Makino) Kitam. 와 Prunus speciosa (Koidz.) Nakai 사이의 인공교배종으로 인식되고 있으나(Wilson, 1916; Innan et al., 1995; Ohta et al., 2006; Nakamura et al., 2015), 교배 기록의 부재와 오랜 재배의 역사로 인하여 그 기원이 명확하게 밝혀지지 않고 있다. 또한, microsatellite 마커를 사용한 연구(Iketani et al., 2007)에서 일본 내의 모든 Someiyoshino cherry 나무들은 하나의 클론형을 가지는 재배품종임이 밝혀진 바 있다.
한편 제주도의 야생 왕벚나무는 1908년에 Taquet신부가 한라산에서 채집한 표본을 기준으로 1912년에 Koehne에 의하여 Prunus yedoensis Matsumura var. nudiflora Koehne라는 학명으로 기재되었으나(Koehne, 1912), Nakai는 1916년에 출판된 조선삼림식물편 5집에서 Prunus yedoensis Matsumura의 이명으로 처리하였다(Nakai, 1916). 이후, 제주도의 야생 왕벚나무와 일본의 Somei-yoshino cherry 는 같은 학명을 사용하는 한편, 서로 공유하는 형태적 유사성(암술대, 꽃자루, 잎자루에 털이 있고 꽃받침에 거치가 있으며, 꽃받침통은 조금 볼록한 원통형)으로 인하여 두 분류군의 분류학적 정체성과 기원 및 원산지에 관한 논란이 지속되어 왔다(Koidzumi, 1932; Takenaka, 1963; Park, 1965; Harn et al., 1977; Jung et al., 1997; Jung et al., 1998; Kim et al., 1998; Roh et al., 2007).
제주도의 야생 왕벚나무는 일본의 Somei-yoshino cherry 와는 달리 그 자생지가 확인된 바 있다(Park et al., 1984; Kim, 1998; Kim et al., 1998; Jung and Oh, 2005). 또한, 야생 왕벚나무의 기원 및 두 분류군 간의 계통분류학적 관계를 밝히기 위하여 isozyme 전기영동법 연구(Harn et al., 1977), 화분학적 연구(Park et al., 1984), RAPD 연구(Jung et al., 1997), 분자계통학적인 연구(Jung et al., 1998; Jung and Oh, 2005; Roh et al., 2007) 등이 이루어졌다. 그러나 이 연구들은 연구의 재현성에 문제가 있거나(Jung et al., 1998; Jung and Oh, 2005), 너무 적은 수의 개체들을 대상으로 연구가 이루어졌으며(Jung and Oh, 2005; Jung et al. 1998), 낮은 해상력으로 인한 유사한 밴드 패턴(Jung et al., 1997; Roh et al., 2007)을 보임으로써, 야생 왕벚나무의 기원을 밝히고 일본의 Somei-yoshino cherry와의 계통분류학적인 관계를 정확하게 보여주지 못하였다.
최근에 Cho et al. (2014)은 제주도에서 자생하고 있는 야생 왕벚나무와 일본으로부터 전해진 재배 왕벚나무(Somei-yoshino cherry), 또한 근연관계에 있는 여러 종류의 벚나무들에 대하여 핵DNA구간인 ITS/ETS/G3pdh 및 엽록체DNA의 non-coding 7 구간의 염기서열 데이터를 이용하여 계통분류학적 연구를 실시하였다. 분석의 결과로서 야생 왕벚나무는 제주도에 분포하는 올벚나무(P. spachiana f. ascendens)가 모계로 작용하였고, 동소적으로 제주도에 분포하는 산벚나무, 벚나무, 잔털벚나무, 사옥 중의 한종이 부계로 작용하여 생겨난 자연 잡종임이 규명되었다. 그러나, 부계로 추정되는 후보종들은 벚나무복합체(Chang et al., 2007)와 산벚나무 복합체(Chang et al., 2004)에 속하는 종들로서, 계통적으로 복잡하게 연결되어 유전적으로 종간 구별이 매우 어려운 집단임이 드러났다. 따라서, Cho et al. (2014)의 연구는 그 중의 어느 종이 야생 왕벚나무의 부계로 작용하였는지를 분명하게 확정하지는 못하였다.
야생 왕벚나무를 처음 채집하였던 Taquet신부는 1902−1915년에 제주도 남제주군 서흥리 성당에서 재직한 프랑스인 사제이다. 그는 재직 중에 제주 특산 식물들을 비롯한 한국의 식물들을 채집하고 표본을 제작하여 한국 식물 연구의 초기 단계에서 귀중한 기록을 남겼다. 이후 목포 본당으로 전임되었다가 1928년부터 1940년에 은퇴할 때까지 대구교구청 산하의 성유스티노신학교장으로 재직하였다. Taquet신부는 성유스티노신학교장 재직시 제주도의 야생 왕벚나무를 대구교구청 내에 옮겨 심었다고 전해져 왔다(대구가톨릭대 사회경제대학원장 정홍규 신부 전언). 대구교구청은 사제이며 식물학자였던 Taquet신부의 업적을 재조명하기 위한 노력의 일환으로 2015년 난대·아열대산림연구소에 의뢰하여 대구교구청 내에 식재되어 있는 오래된 왕벚나무에 대한 수령을 조사한 결과, Taquet신부의 묘지가 있는 천주교 대구교구청의 성직자 묘역 부근에서 자라고 있는 오래된 왕벚나무 두 그루의 수령이 Taquet신부의 성유스티노신학교장 재직시기와 일치함으로써(Warm-Temperate and Subtropical Forest Research Center. 2015) 이들이 제주도의 야생 왕벚나무일 가능성이 제기되었다.
본 연구는 대구교구청의 왕벚나무를 포함하여 한국과 일본에서 채집된 대표적인 야생 왕벚나무 및 재배 왕벚나무들을 대상으로 두 분류군에 대한 변별력이 있는 cpDNA 분자 마커를 사용하여 분자계통분류학적 분석을 수행하였다. 즉, 야생 왕벚나무와 재배 왕벚나무에 대한 계통분류학적 비교 분석을 수행함으로써 대구교구청의 오래된 왕벚나무들의 기원을 추적하는 동시에, 야생 왕벚나무와 재배 왕벚나무의 유연관계를 밝히고자 하였다.

재료 및 방법

실험재료

본 연구에서는 제주도의 한라산에서 자생하고 있는 왕벚나무와 한국과 일본에서 식재되고 있는 재배 왕벚나무 및 그들과 근연관계를 가진 올벚나무를 포함하였다. 재배 왕벚나무(Somei-yoshino cherry)는 Prunus × yedoensis ‘Somei-yoshino’로 지칭하였고(Iketani et al., 2006), 제주도 야생 왕벚나무의 경우 기존의 학명인 Prunus yedoensis를 사용하였다. 제주도에 자생하는 야생 왕벚나무 개체들과 올벚나무 개체들은 2011년부터 2012년까지 제주도에서 채집하였으며, 일본에서 자생하고 있는 올벚나무는 2013년에 일본을 방문하여 채집하였다. 왕벚나무 재배품종은 일본의 Koishikawa 식물원과 일본에서 직접 들여온 묘목을 식재하였다고 알려진 한국의 진해 해군기지, 제주대학교 앞과 서울대학교 교정에서 채집한 개체들을 실험에 사용하였다. 제주도 자생 올벚나무 3 개체와 일본 자생 올벚나무 2 개체를 합하여 모두 5 개체의 올벚나무와 제주도의 야생 왕벚나무 10 개체와 왕벚나무 재배품종 5 개체가 분석에 사용되었다. 왕벚나무 재배품종 5 개체 중, 3 개체는 국내에서 채집하였고, 2 개체는 일본의 Koishikawa 식물원에서 채집하였다. Taquet신부가 한라산에서 채집하여 대구에 옮겨 심었다고 추정되는 왕벚나무 개체들을 포함하여 천주교 대구교구청 내에서 3 개체, 국채보상운동 기념공원에서 2 개체의 오래된 왕벚나무를 채집하였다. 따라서 총 25 개체의 올벚나무와 왕벚나무 복합체(Prunus yedoensis/P. spachiana f. ascendens complex)의 재료와 함께 외군(outgroup)으로 사용하기 위하여 전라남도 해남에서 채집된 잔털벚나무 1 개체를 포함 하였다(Table 1).

DNA의 추출, 증폭 및 염기서열 정렬과 분석

어리고 신선한 잎을 채집하여 silica gel과 동봉하여 즉시 건조 시킨 후, DNeasy Plant Mini Kit (Qiagen, Carlsbad, California, USA)를 이용하여 DNA를 추출하였으며 모든 처리과정은 공급자의 안내서에 따라 수행하였다.
기초 실험을 통하여 cpDNA의 여러 구간을 조사한 후 야생 왕벚나무와 재배 왕벚나무 간에 변이가 있고 계통학적 의미가 있는 2개의 구간(rpl16 유전자와 trnS-trnG intergenic spacer)에 대하여 중합효소연쇄반응(PCR: Polymerase Chain Reaction)을 실시하였으며, 사용한 프라이머(primer)에 대한 정보는 Table 2에 명시하였다. PCR 조건은 95˚C에서 2분간 predenaturation 후, 95˚C에서 1분간 denaturation, 52˚C에서 2분간 annealing, 72˚C에서 2분간 extension하는 과정을 35cycle로 반복 시행한 후, additional extension을 위해 72˚C에서 10분간 유지하였다. 증폭된 PCR산물은 PCR 정제 키트(Qiagen Qiaquick PCR Purification Kit)로 정제한 후 전문 업체(Geno Tech Corp., Daejeon, Korea)에 의뢰하여 BigDye Terminator Cycle Sequencing 키트로 염기서열을 결정하였다. 얻어진 염기서열은 Sequencher Version 4.7 (Gene Codes Corporation, Ann Arbor, MI)을 사용하여 Contig를 만 들고 완성된 자료를 MacClade 4.04 (Maddison & Maddison, 2005)로 교정과 조합을 하였다.

계통분석

cpDNA 두 구간의 염기서열을 통합한 데이터를 이용하여 PAUP*4.0b10 (Swofford, 2002)의 MP (Maximum parsimony) 분석의 heuristic search 방식으로 계통수를 작성하였다. 갭(gap)을 결여형질(missing character)로 처리하고, 모든 형질에 동일한 가중치를 부여하였으며, Tree-Bisection-Reconnection (TBR)과 ‘MulTrees’ option을 사용하였다. 또한 분계의 신뢰도를 측정하기 위해 형질 재추출 과정을 1000회 반복하는 부트스트랩 분석(Felsenstein, 1985)을 수행하여 계통수의 각 가지 위에 부트스트랩 지수와 변이의 숫자를 표시하였다. 본 연구의 실험대상인 올벚나무와 왕벚나무복합체 계통수의 진화 방향을 설정하기 위하여 이 복합체에 속하지 않는 잔털벚나무 1 개체를 외군으로 사용하였다. 또한, 유전적으로 밀접하게 연관되어 있는 올벚나무와 왕벚나무 복합체의 유전적 구조를 파악하기 위하여 ‘statistical parsimony’(SP) 방식을 차용하는 TCS Haplotype Networking (Clement et al., 2000)을 실시하였다.

결 과

rpl16 유전자 구간(297 base pair)과 trnS-trnG intergenic 구간(393 base pair)을 정렬하여 통합한 결과, 총 길이 690 bp의 염기서열을 얻었다. 그 중에서 변이가 없는 형질(constant character)은 688 bp였고, 변이의 숫자는 총 2 bp로서 모두 계통학적으로 유효한 형질이었다. MP 분석 결과 1개의 계통수를 얻었다(Tree length=2, CI=1, RI=1; Fig. 1A). 실험대상군인 올벚나무와 왕벚나무 복합체 내에서는 2 개의 분계조(Clade A/B)가 형성되었고, 올벚나무와 왕벚나무 개체들 중 일부가 이 두 분계조와의 유연관계가 명확하게 나타나지 않은 채로 계통수의 기부에 위치하였다. 기부에 위치한 개체들은 일본과 제주도의 신비의 도로 근처에서 채집된 올벚나무 개체들과 제주도의 대포동(YE92)과 봉개동 왕벚나무 자생지(YE826JJ1)에서 채집된 야생 왕벚나무였다. 64%의 부트스트랩 지수로 지지된 Clade A와 Clade B는 trnS-trnG intergenic 구간과 rpl16 유전자 구간에서 각기 1 bp의 차이를 보이며 분지하였다. 단계통군을 형성한 첫 번째 분계조(Clade A)의 구성원들은 모두 제주도에서 자생하는 야생의 왕벚나무와 올벚나무였다. 두 번째 분계조(Clade B)는 대부분 왕벚나무 재배품종들로 이루어진 집단으로서 일본과 한국에서 채집된 왕벚나무 재배품종들과, 특이하게도 관음사 주변에서 채집된 야생 왕벚나무 한 개체(YE833JJ2)를 포함하였다. 대구교구청에서 채집된 왕벚나무 3 개체들(YETQ1−3)과 국채보상운동기념공원에서 채집된 2 개체들(YETQ4−5)은 모두 Clade B에 포함되었다(Fig. 1A).
외군인 잔털벚나무를 제외한 올벚나무와 왕벚나무 복합체에 대한 TCS 네트워크 분석에서는 3 개의 반수체형(haplotype)이 구분되었으며, 고리 구조는 발견되지 않았 다(Fig. 1B). 각 반수체형의 구성 개체 및 네트워크 간의 관계는 계통수의 topology와 일치하였다. Haplotype A를 보유한 것으로 나타난 개체들은 계통수 상에서 기부에 위치하였던 개체들로서 제주도의 야생 왕벚나무(YE92, YE826JJ)와 제주와 일본에서 채집한 일부 올벚나무였다. Haplotype B는 제주도에서 자생하고 있는 야생 왕벚나무와 올벚나무가 보유한 고유의 반수체형으로 드러났으며 계통수 상에서 Clade A에 속하였던 구성원들 모두가 haplotype B에 속하였다. Haplotype C 에는 계통수 상의 Clade B에 속하였던 일본의 Somei-yoshino cherry와 일본으로부터 들여와 한국에서 식재되고 있는 재배 왕벚나무들이 모두 포함되어, haplotype C는 재배 왕벚나무의 특징적 반수체형임을 보여주었다. Taquet 신부와 관련하여 대구에서 채집된 5 개체의 왕벚나무들(YETQ1−5) 또한 모두 haplotype C에 속하였다. 제주도의 관음사 근처에서 채집된 야생 왕벚나무 1 개체(YE833JJ2)는 계통수에서와 마찬가지로 재배품종의 반수체형(haplotype)으로 밝혀진 haplotype C에 포함되었다.

고 찰

제주도에 자생하고 있는 야생 왕벚나무는 일본과 한국을 비롯한 동아시아와 미국 등지에서 널리 식재되고 있는 일본의 대표적인 원예 재배품종인 Somei-yoshino cherry와는 형태적으로 거의 구별이 가지 않는 유사성을 보이고 있어서 형태 형질에 대한 분석 만으로는 두 분류군 사이의 경계를 긋기 힘들다. 기존의 분자생물학적 연구들(Jung et al., 1998; Jung and Oh, 2005; Roh et al., 2007; Cho et al., 2014)에서도 두 분류군 간의 계통적 유연관계를 명 확하게 밝히지 못하여 제주도의 야생 왕벚나무와 재배 왕벚나무의 기원 및 원산지에 대한 논란은 계속되고 있다. 본 연구는 cpDNA 분자 마커를 사용한 엽록체 DNA 계통 수와 반수체형 네트워크를 통하여 두 분류군이 유전적으로 거리가 있는 독립적인 분류군일 가능성을 제시하였다. 이와 같은 결과는 엽록체 DNA의 rpl16 과 trnL-F 구간의 반수체형과 ISSR 마커를 사용하여 두 분류군이 충분히 다르다는 Roh et al. (2007)의 결론과 일치하는 부분이 있다. 그들의 결론은 ISSR 마커의 phenogram에서 Somei-yoshino cherry는 일부 개체를 제외하면 대부분 야생 왕벚나무와는 먼 관계를 보였다는 점, 또한 rpl16 유전자와 trnL-F intergenic구간에서 제주의 야생 왕벚나무는 “TA” 와 “AA” 의 두 반수체형을 가지고 있었으나 일본과 미국에서 채집된 재배 왕벚나무은 “AA” 반수체형을 가지고 있었다는 점에 근거하고 있다. 그러나, rpl16 유전자와 trnL-F intergenic구간의 분석 데이터만으로는 두 분류군이 다르다라고 해석하기보다는 재배 왕벚나무가 한국의 야생 왕벚나무로부터 유래되었고 따라서 두 분류군은 분류학적으로 일치한다고 해석하는 것이 오히려 더 자연스러울 것이다. 게다가 Roh et al. (2007)의 연구에서는 재배 왕벚나무의 다른 품종인 “Akebono” 가 야생 왕벚나무의 또 다른 반수체형인 “TA”를 가지고 있는 것으로 나타났다. 또한, 한국산 올벚나무는 재배 왕벚나무에 존재하지 않는 고유한 반수체형(haplotype)을 가진 것으로 나타나 재배 왕벚나무의 기원과는 관련성이 없었으나, 일본의 올벚나무는 제주산 자생 왕벚나무 반수체형의 일종인 “TA” 반수체형을 가지고 있는 것으로 나타났다. 즉 동일한 반수체형이 일본 올벚나무, 제주도에 자생하는 야생 왕벚나무와 Yoshino cherry ‘Akebono’에서 나타났다. 이는 일본의 올벚나무가 재배 왕벚나무의 잡종기원에서 모계쪽으로 기여한 것으로 알려져 있는 사실(Innan et al., 1995; Ohta et al., 2006; Nakamura et al., 2015)로 미루어 볼 때 매우 이례적이다. 그 원인으로는 교배기원에 직접적으로 관련된 반수체형을 가진 개체가 채집되지 못하였거나, 불충분한 염기서열 정보가 분석에 사용되어 각 분류군이 보유한 고유의 반수체형을 변별해내지 못하였기 때문이라고 추정되지만 Roh et al. (2007)의 연구에서는 이에 대한 적절한 설명은 제공되지 않았다.
한편, 본 연구는 야생 왕벚나무가 고유의 반수체형을 보유하고 있으며 야생 왕벚나무의 고유한 반수체형은 제주도에 자생하는 올벚나무와도 공유하고 있음을 규명하였다. 이는 제주도에 자생하는 올벚나무가 야생 왕벚나무의 자연교배 기원에서 모계 쪽으로 기여한 것을 밝혔던 기존 연구(Cho et al., 2014)와도 일치한다. 야생 왕벚나무는 제주도에서 진행된 종분화 과정으로 인하여 탄생하였고 종분화 과정에 중심적 역할을 수행한 유전자교환은 양방향으로, 또한 여러 번 일어났으므로, 야생 왕벚나무는 재배 왕벚나무에 비하여 형태적, 유전적 변이의 폭이 더 크다(Kim et al., 1998; Cho et al., 2014).
본 연구에서는 올벚나무와 왕벚나무복합체 내의 유전적 다양성을 알아보기 위하여 모계쪽의 유전 경로로 알려진 엽록체 DNA의 2 구간만을 사용하였음에도 불구하고, 야생 왕벚나무는 A, B, C의 모든 반수체형(haplotype)을 보유함으로써 haplotype C, 즉 1 개의 반수체형만을 보유한 재배 왕벚나무에 비하여 상대적으로 높은 반수체형 다양성을 보여 주었다 (Fig. 1B). 대부분의 야생 왕벚나무는 haplotype B를 보유하였으나, 봉개동 왕벚나무 자생지에서 채집한 야생 왕벚나무 한 개체(YE826JJ1)와 대포동의 왕벚나무 자생지에서 채집한 야생 왕벚나무(YE92)는 한국과 일본의 올벚나무가 공유하고 있는 haplotype A를 가지고 있는 것으로 파악되었다. 이러한 결과는 이 두 야생 왕벚나무 개체가 haplotype B를 가지고 있는 대부분의 야생 왕벚나무의 모계 올벚나무와는 다른 계통의 올벚나무가 모계쪽으로 기여한 것으로 추정된다. Haplotype C는 관음사 주변에서 채집된 야생 왕벚나무 한 개체(YE833JJ2)를 제외하고 모두 재배 왕벚나무들로 구성되어 있었으며, haplotype A와 한 개의 염기서열의 차이를 보였으나 대부분의 야생 왕벚나무가 가진 고유의 haplotype B와는 상대적으로 거리가 있는 것으로 드러났다. 즉, 관음사 주변에서 채집된 야생 왕벚나무 한 개체(YE833JJ2)를 제외한다면 한국의 자생 왕벚나무나 올벚나무를 한 개체도 포함하지 않은 Haplotype C는 재배 왕벚나무 고유의 반수체형이라고 할 수 있다. 그와 동시에 일본의 Somei-yoshino cherry 나 한국에서 채집된 재배 왕벚나무들 또한 haplotype B에는 한 개체도 포함되지 않았다. 소수의 야생 왕벚나무들이 포함된 haplotype A도 비록 재배 왕벚나무의 고유 haplotype인 C와 근연관계를 보였지만 재배 왕벚나무는 1 개체도 포함하지 않음으로써, 야생 왕벚나무와 재배 왕벚나무는 유전적으로 기원이 다른 분류군임을 시사하고 있다. 추가적으로, 일본의 올벚나무와 haplotype A를 공유하고 있는 야생 왕벚나무 개체들(YE92, YE826JJ)에 대하여 는 재배 왕벚나무의 부모종으로 추정되는 일본 올벚나무와 P. speciosa를 충분히 포함시켜 야생 왕벚나무와 재배 왕벚나무 간의 유연관계를 보다 명확하게 규명하는 후속연구가 필요하다.
관음사 일대에서 채집된 야생 왕벚나무 한 개체(YE833JJ2)는 본 분석에 포함된 다른 야생 왕벚나무와는 달리 왕벚나무 재배품종의 반수체형을 보유함으로써, 과연 이 개체가 진정한 야생 왕벚나무인지, 아니면 재배 왕벚나무인지에 관한 분류학적 의문을 불러 일으키고 있다. 만약 재배 왕벚나무의 유전자형과 일치하는 유전자형을 가진 이 개체가 야생 왕벚나무의 다양한 유전자형 중의 1 개 유전자형이라면, 일본의 Somei-yoshino cherry의 기원에 제주도의 야생 왕벚나무가 기여하였을 가능성을 배제할 수 없기 때문이다. 그러나, 현재까지의 연구 결과 만으로는 그 가능성을 확언할 수 없다. 이 개체가 속한 재배 왕벚나무의 haplotype C는 야생 왕벚나무의 모계종인 한국 올벚나무를 한 개체도 포함하지 않음으로써 이 개체와 한국 올벚나무는 유전적으로 어떠한 근연관계도 보이지 않고 있다. 오히려, 도로변에 식재되었던 왕벚나무 재배품종이 야생으로 탈출하여 멀지 않은 관음사 근처의 숲속으로 펴져나갔거나 아니면 절 주변 숲에 재배 왕벚나무를 관상용으로 식재한 적이 있어서 채집지 숲 속에는 야생 왕벚나무와 재배 왕벚나무가 혼재되어 있었고, 채집시 재배 왕벚나무를 야생 왕벚나무로 오인하였을 가능성이 더 크다. YE833JJ2의 채집지와 가까운 관음사 주변의 숲속에서 채집된 다른 개체(YE873)는 야생 왕벚나무의 반수체형을 가지고 있는 것으로 확인되었다(Fig. 1). 형태적 유사성을 공유하는 두 분류군 간의 판정은 수령 및 채집 장소를 고려하여 이루어지는 경향이 크므로 채집 장소의 특이성에 따라 오동정의 가능성이 있다. 즉 재배 왕벚나무는 주로 주거지나 도로변에 식재되고 있으나 야생 왕벚나무는 주로 인간 활동의 간섭이 없는 고립된 숲 속에서 발견되고 있다. 다른 연구자의 연구에서도 YE833JJ2와 같은 장소에서 채집된 야생 왕벚나무의 다른 개체가 재배 왕벚나무의 반수체형을 보인 예가 있다(Roh et al., 2007). 그러나, 아직은 이 개체가 야생 왕벚나무의 일종일 가능성을 완전히 배제할 수는 없다. 비록 이 개체가 본 연구에서는 재배 왕벚나무들과 같은 반수체형을 보이고 있지만, 관음사 지역의 왕벚나무의 기원에 대하여는 변별력이 있는 마커를 추가하여 보다 자세한 후속 연구가 필요하다.
또한 본 연구에서는 한국에 분포하는 올벚나무와 일본에 분포하는 올벚나무 간의 유전적 다양성과 이들과 왕벚나무와의 관계에 관해 기초적인 결과를 제시해주고 있다. 한국의 자생 올벚나무는 haplotype A와 B, 두 개의 반수체형을 가지고 있는 것으로 파악되었고(Fig. 1B), 이와 같은 한국 올벚나무의 반수체형 다양성은 야생 왕벚나무의 종분화 과정에서 필연적으로 야생 왕벚나무에게 전달되었다고 추론할 수 있다. 야생의 왕벚나무들과 공유하고 있는 haplotype B는 한국의 올벚나무에만 존재하는 고유한 반수체형이었으나, haplotype A는 한국과 일본의 올벚나무가 함께 공유하고 있는 반수체형이었다. 즉, 한국과 일본의 올벚나무는 같은 반수체형을 공유하는 동시에, 또한 각각의 고유한 반수체형을 유지하고 있으며, 같은 종에 속하지만 지역적인 분포가 다른 이 두 분류군 사이에는 유전적 차이점이 실재한다고 추정된다. 다만, 재배 왕벚나무 고유의 반수체형으로 밝혀진 haplotype C에서 일본 올벚나무의 고유한 반수체형이 나타나지 않은 점에 대하여는 추가 연구가 필요하다. Somei-yoshino cherry는 일본의 올벚나무, P. spachiana f. ascendensP. speciosa 의 인공교배종으로 인지되고 있으므로, 모계 쪽으로 기여한 일본 올벚나무가 재배 왕벚나무와 근연관계를 보이며 haplotype C를 공유할 것으로 기대되었기 때문이다. 기대와 다르게 나타난 원인으로는 본 연구에서 극히 좁은 범위에서 채집된 소수 개체(PP377 006, PP382 034)의 일본 올벚나무만 사용되었으므로 일본 내 올벚나무의 유전적 다양성을 충분히 반영하지 못하였기 때문인 것으로 사료된다. 일본의 Somei-yoshino cherry의 모계 부모종인 일본 올벚나무의 야생 집단에 대하여 보다 넓은 범위의 지역에서 충분한 개체들을 확보하여, 한국의 올벚나무와의 비교 분석을 통하여 야생 왕벚나무와 재배 왕벚나무의 모계쪽 계통 분석이 필요하다.
대구에서 채집된 왕벚나무 5 개체는 모두 재배 왕벚나무의 고유 반수체형인 haplotype C에 포함되었으며(Fig. 1B), 엽록체 DNA 계통수 상에서도 다른 재배 왕벚나무들과 함께 두 번째 분계조(Clade B)에 속하였다(Fig. 1A). 이와 같이, Taquet 신부가 제주도로부터 대구교구청으로 옮겨 심었을 것으로 추정되었던 수령이 오래된 왕벚나무 두 그루는 대구의 국채보상운동기념공원에 식재된 재배 왕벚나무나 실험에 포함된 다른 재배 왕벚나무와 유전적인 차이를 보이지 않았다. 따라서 이 개체들은 그 시기는 알 수 없으나, 재배 왕벚나무들로서 Taquet 신부가 발견했던 제주도의 야생 왕벚나무와의 관련성은 매우 낮다고 추정된다. Taquet 신부가 관음사 뒷산 해발 약 600 m 지점의 숲 속에서 왕벚나무를 발견하여 베를린 대학의 Koehne에게 표본을 보낸 시기는 1908년이었고, 제주도에서 처음으로 왕벚나무 재배품종을 식재하기 시작한 시기는 1935년경, 당시의 서귀포 면장이 일본에서 왕벚나무 묘목을 대량으로 들여와 서귀포를 중심으로 일주도로의 가로수로 식재한 것이 그 시초라고 알려져 있다(Park, 1965). Taquet 신부가 한라산에서 발견한 야생 왕벚나무는 1908년 당시에 이미 수령이 수십 년은 된 것으로 관측되었으므로 왕벚나무 재배품종과는 관계가 없는 야생 왕벚나무였을 것으로 추정된다. Taquet 신부가 제주도에 재배 왕벚나무를 식재하기 이전에 야생 왕벚나무를 대구로 이식했다면 그들이 재배 왕벚나무의 반수체형을 보유하게 될 가능성은 거의 없다. 또한 대구로 옮겨 간 시기가 제주도에 재배 왕벚나무를 식재한 이후였다고 가정해도 Taquet 신부가 야생 왕벚나무가 아닌 재배 왕벚나무를 옮기는 실수를 하였을 가능성은 거의 없어 보인다. 단, 관음사 주변에서 채집된 야생 왕벚나무 한 개체가 haplotype C에 포함됨으로써, 또 다른 가능성을 가정할 수는 있다. 즉, 관음사 근처에는 재배품종과 같은 haplotype C를 보유한 야생 왕벚나무 개체들이 존재하였고, Taquet 신부가 이들 중의 1 개 이상의 개체를 관음사 주변에서 채집하여 천주교 대구교구청에 이식하였을 가능성이다. 그러나, 현재 대구교구청의 오래된 왕벚나무는 반수체형 네트워크 상에서 haplotype C를 보유하며 haplotype B를 보유한 야생 왕벚나무와 유전적 거리가 멀 뿐 아니라, 야생 왕벚나무의 기원에 관여한 한국 올벚나무와도 근연관계를 보이지 않았다. 그러므로 대구교구청의 오래된 왕벚나무 두 그루도 수령분석 결과에 따라 Taquet 신부가 심었을 가능성이 있다고 추정된다하여도 제주도로부터 이식한 야생 왕벚나무는 아니라고 판단된다.

Acknowledgments

본 연구는 국립산림과학원 난대·아열대산림연구소의 위탁연구과제(제2016-9호)의 일부 지원으로 수행되었다. 또한 원고에 대한 적절한 논평과 제안으로 이 논문의 완성도를 높일 수 있도록 도와주신 심사위원들께 감사 드린다.

Fig 1.
A. The most parsimonious tree based on the concatenated cpDNA sequences of rpl16 gene and trnS-trnG intergenic regions. Number of substitutions and bootstrap value are shown above branches, respectively. B. Haplotype network based on the cpDNA data representing three haplotypes. Circle size is proportional to the frequencies of haplotype.
kjpt-46-2-247f1.gif
Table 1.
The list of samples included in this study. Voucher specimens are deposited in the Ha Eun Herbarium, Sungkyunkwan University (SKK).
DNA number Collection Site Collection Date Voucher Specimen
Prunus spachiana f. ascendens (Makino) Kitam., collected from Jeju and Japan
PE809 Mysterious Road, Jeju Apr. 12, 2011 Cho et al. 110412126
PE832 Kwaneumsa, Jeju Apr. 19, 2011 Cho et al. 110419133
PE857 Youngsil, Jeju May 2, 2011 Cho et al. 110502134
PP377 006 Aobaku, Sendai, Japan Apr. 22, 2013 Cho et al. 130422006
PP382 034 Mukaiyama , Sendai, Japan Apr. 22, 2013 Cho et al. 130422034

Prunus yedoensis Matsum., wild and endemic to Jeju Island, Korea

YE3-A Haryeri Natural Stand, Jeju May 3, 2011 Cho et al. 110413101
YE92 Daepodong, Jeju May 10, 2012 Cho et al. 120417103
YE814 Wimiri, Jeju Apr. 13, 2011 Cho et al. 110413105
YE826JJ1 Bonggae Natural Stand, Jeju Apr. 18, 2011 Cho et al. 110413106
YE826JJ2 Bonggae Natural Stand, Jeju Apr. 18, 2011 Cho et al. 110413107
YE833JJ2 Kwaneumsa, Jeju Apr. 19, 2011 Cho et al. 110419108
YE873 Kwaneumsa, Jeju May 3, 2011 Cho et al. 110503111
YE868 Sinryeri Natural Stand, Jeju May 3, 2011 Cho et al. 110503109
YE872 Seongpangyo, Jeju May 3, 2011 Cho et al. 110503110
YE879 Eorimok, Jeju May 3, 2011 Cho et al. 110503114

Prunus ×yedoensis ‘Somei-yoshino’, cultivated (Somei-yoshino cherry)

xYE808 Jeju University, Jeju Apr. 12, 2011 Cho et al. 110412116
xYE JINHAE Jinhae, Gyeongsangnam-do Apr. 29, 2012 Cho et al. 120429120
xYE SNU-K Seoul National University, Seoul Apr. 26, 2012 Cho et al. 120426121
xYE KO5041 Koishikawa Botanical Garden,Tokyo Apr. 18. 2013 None
xYE KO4981 Koishikawa Botanical Garden,Tokyo Apr. 18. 2013 None

Purported as wild Prunus yedoensis Matsum., collected from Daegu

YETQ1 Catholic Archdiocese of Daegu June 25, 2015 None
YETQ2 Catholic Archdiocese of Daegu June 25, 2015 None
YETQ3 Catholic Archdiocese of Daegu July 09, 2015 None
YETQ4 The Foreign Debt Redemption Movement Memorial Park, Daegu July 09, 2015 None
YETQ5 The Foreign Debt Redemption Movement Memorial Park, Daegu July 09, 2015 None

Outgroup Prunus serrulata Lindl. var. pubescens (Makino) Nakai

PB10-2DR Dooryunsan Natural Stand, Haenam Apr. 17, 2012 Cho et al. 120417137
Table 2.
The sequence information of primers used for PCR and DNA sequencing.
cpDNA region Forward (5’-3’) Reverse (5’-3’) Reference
rpl16 gene TTGCTTCGGTAGATATGCTCTTC CAAAGACCCCTTTCCTTTGT Roh et al., 2007
trnS-trnG intergenic spacer AGATAGGGATTCGAACCCTCGGT TTTTACCACTAAACTATACCCGC Shaw et al., 2005

Literature Cited

Bailey, L. H. and Bailey, E. Z.. 1976. Prunus L. Hortus Third; A Concise Dictionary of Plants Cultivated in the United States and Canada. Macmillan Publishing Company, New York.

Chang, C. S.. Choi, H. and Chang, K. S.. 2004. Reconsideration of Prunus sargentii complex in Korea: With respect to P. sargentii and P. takesimensis. Korean Journal of Plant Taxonomy 34: 221-244 (in Korean).

Chang, K. S.. Chang, C. S.. Park, T. Y. and Roh, M. S.. 2007. Reconsideration of the Prunus serrulata complex (Rosaceae) and related taxa in eastern Asia. Botanical Journal of the Linnean Society 154: 35-54.
crossref
Cheng, S.. Mcbride, J. R. and Fukunar, K.. 2000. The urban forest of Tokyo. Arboricultural Journal 23: 379-392.
crossref
Cho, M. S.. Kim, C. S.. Kim, S. H.. Kim, T. O.. Heo, K. I.. Jun, J. and Kim, C.. 2014. Molecular and morphological data reveal hybrid origin of wild Prunus yedoensis (Rosaceae) from Jeju Island, Korea: Implications for the origin of the flowering cherry. American Journal of Botany 101: 1976-1986.
crossref pmid
Clement, M.. Posada, D. and Crandall, K. A.. 2000. TCS: A computer program to estimate gene genealogies. Molecular Ecology 9: 1657-1659.
crossref pmid
Felsenstein, J. 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39: 783-791.
crossref
Gray, A. 1856. Manual of the botany of the northern United States, including Virginia, Kentucky, and all east of the Mississippi: arranged according to the natural system. 2nd ed. George P. Putnam & Co., New York.

Harn, C.. Kim, Y. J.. Yang, S. Y. and Chung, H. J.. 1977. Studies on the origin of Prunus yedoensis Matsumura. 1. A comparative electrophoretic study on wild P. subhirtella in Mt. Hanla, cultivated P. yedoensis and P. subhirtella. Korean Journal of Botany 20: 1-5 (in Korean).

Iketani, H.. Katsuki, T. and Kawahara, T.. 2006. Prunus ×yedoensis ‘Somei-yoshino’, a correct cultivar name for Yoshino cherry. Journal of Japanese Botany 81: 123-125.

Iketani, H.. Ohta, S.. Kawahara, T.. Katsuki, T.. Mase, N.. Sato, Y. and Yamamoto, T.. 2007. Analyses of clonal ctatus in ‘Someiyoshino’ and confirmation of genealogical record in other cultivars of Prunus ×yedoensis by microsatellite markers. Breeding Science 57: 1-6.
crossref
Innan, H.. Terauchi, R.. Miyashita, N. T. and Tsunewaki, K.. 1995. DNA fingerprinting study on the intraspecific variation and the origin of Prunus yedoensis (Somei yoshino). Japanese Journal of Genetics 70: 185-196.
crossref pmid
Iwasaki, F.. 1991. Investigations on wild somei-yoshino (Prunus yedoensis Matsumura) and related varieties. Bulletin of Agricultural and Forestry Research Center, University of Tsukuba 3: 95-110.

Jung, Y. H.. Ko, M. H.. Oh, Y. S.. Kim, G. O.. Chung, Y. C.. Kim, M. H. and Oh, M. Y.. 1997. Phylogenetic relationship among selected taxa of Prunus in Mt. Halla and cultivated Prunus yedoensis by the RAPD analysis. Korean Journal of Plant Taxonomy 27: 415-428 (in Korean).

Jung, Y. H.. Ko, M. H.. Oh, Y. S.. Han, S. H.. Kim, M. H.. Koh, S. C. and Oh, M. Y.. 1998. Genetic relationship of Prunus yedoensis, native and cultivated, based on internal transcribed spacer sequences of ribosomal DNA. Korean Journal of Genetics 20: 109-116 (in Korean).

Jung, Y. H. and Oh, M. Y.. 2005. Phylogenetic relationships of Prunus (Rosaceae) in Korea and Japan inferred from chloroplast DNA sequences. Korean Journal of Genetics 27: 279-288.

Kato, S.. Matsumoto, A.. Yoshimura, K.. Katsuki, T.. Iwamoto, K.. Kawahara, T.. Mukai, Y.. Tsuda, Y.. Ishio, S.. Nakamura, K. and Moriwaki, K.. 2014. Origins of Japanese flowering cherry (Prunus subgenus Cerasus) cultivars revealed using nuclear SSR markers. Tree Genetics & Genomes 10: 477-487.
crossref
Kim, C. S.. 1998. Distribution and taxonomic study of Prunus yedoensis Matsumura (Rosaceae). Ph. D. Dissertation, Cheju National University; Jeju, Korea. (in Korean).

Kim, C. S.. Lee, K. Y.. Moon, M. K.. Hyun, H. J.. Ihm, B. S. and Kim, M. H.. 1998. Natural habitat of Prunus yedoensis Matsumura and its morphological variation. Korean Journal of Plant Taxonomy 28: 117-137 (in Korean).

Koehne, E.. 1912. 96. Prunus yedoensis Matsum. var. nudiflora Koehne. Repertorium Specierum Novarum Regni Vegetabilis 10: 507 (in German).
crossref
Koidzumi, G.. 1932. Prunus yedoensis Matsum. is a native of Quelpaert. Acta Phytotaxonomica et Geobotanica 1: 177-179.

Krssmann, G.. 1986. Cultivated broad-leaved trees and shrubs. BT Batsford Ltd, London.

Lee, T. B.. 2003. Coloured Flora of Korea. Hyangmunsa, Seoul. (in Korean).

Matsumura, J.. 1901. Cerasi Japanicae duae species novae. The Botanical Magazine Tokyo 15: 99-101.
crossref
Nakai, T.. 1916. Flora Sylvatica Koreana. Vol. 5. Government of Chsen, Forestal Experiment Station, Seoul. (in Japanese).

Nakamura, I.. Takahashi, H.. Ohta, S.. Moriizumi, T.. Hanashiro, Y.. Sato, Y. I. and Mii, M.. 2015. Origin of Prunus ×yedoensis ‘Somei-yoshino’ based on sequence analysis of PolAI gene. Advances in Horticultural Science 29: 17-23.

Ohta, S.. Osumi, S.. Katsuki, T.. Nakamura, I.. Yamamoto, T. and Sato, Y. I.. 2006. Genetic characterization of flowering cherries (Prunus subgenus Cerasus) using rpl16-rpl14 spacer sequences of chloroplast DNA. Journal of the Japanese Society for Horticultural Science 75: 72-78.
crossref
Park, M. K.. 1965. A historological survey on the Prunus yedoensis in Korea. Korean Journal of Botany 8: 12-15 (in Korean).

Park, S. H.. Kim, M. H.. Lee, S. and Sim, K. K.. 1984. A palynological study of some Prunus in Mt. Halla. Korean Journal of Plant Taxonomy 14: 153-159 (in Korean).

Roh, M. S.. Cheong, E. J.. Choi, I. Y. and Joung, Y. H.. 2007. Characterization of wild Prunus yedoensis analyzed by inter-simple sequence repeat and chloroplast DNA. Scientia Horticulturae 114: 121-128.
crossref
Shaw, J.. Lickey, E. B.. Beck, J. T.. Farmer, S. B.. Liu, W.. Miller, J.. Siripun, K. C.. Winder, C. T.. Schilling, E. E. and Small, R. L.. 2005. The tortoise and the hare II: Relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. American Journal of Botany 92: 142-166.
crossref pmid
Swofford, D. L.. 2002. PAUP*.Phylogenetic analysis using parsimony (*and other methods) version 4.0. Sinauer Associates, Sunderland, MA.

Takenaka, Y.. 1963. The origin of Yoshino cherry tree. Journal of Heredity 54: 207-211.

Warm-Temperate and Subtropical Forest Research Center. 2015. Investigation report on flowering cherries in Catholic Archdiocese of Daegu: 1−2. (in Korean).

Wilson, E. H.. 1916. The Cherries of Japan. Univ. Press, Cambridge, MA, USA.

Yu, T. T. and Li, C. L.. 1986. Cerasus. Flora Reipublicae Popularis Sinicae 38. Yu, T. T. (ed.), Science Press, Beijing. Pp. 1-133 (in Chinese).

Editorial Office
Korean Journal of Plant Taxonomy
Department of Life Sciences, Hallym University, Chuncheon 200-702, Korea
TEL: +82-33-248-2095   FAX: +82-33-256-3420    E-mail: kjpt1968@gmail.com
About |  Browse Articles |  Current Issue |  For Authors and Reviewers
Copyright © Korean Society of Plant Taxonomists. All rights reserved.