| Home | E-Submission | Sitemap | Editorial Office |  
top_img
Korean J. Pl. Taxon > Volume 48(3); 2018 > Article
JUNG, KANG, YOO, KWAK, KIM, and KIM: Isolation and characterization of EST-SSR markers for Astilboides tabularis (Saxifragaceae), endangered species in Korea

Abstract

Genetic assessments of rare and endangered species are among the first steps necessary to establish the proper management of natural populations. Transcriptome-derived single-sequence repeat markers were developed for the Korean endangered species Astilboides tabularis (Saxifragaceae) to assess its genetic diversity. A total of 96 candidate microsatellite loci were isolated based on transcriptome data using Illumina pair end sequencing. Of these, 26 were polymorphic, with one to five alleles per locus in 60 individuals from three populations of A. tabularis. The observed and expected heterozygosity per locus ranged from 0.000 to 0.950 and from 0.000 to 0.741, respectively. These polymorphic transcriptome-derived simple sequence repeat markers would be invaluable for future studies of population genetics and for ecological conservation of the endangered species A. tabularis.

Astilboides tabularis (Hemsl.) Engler is the only species in Astilboides (Saxifragaceae) known to be distributed in a cluster in the forests of river valleys of northeastern Korea and China (Jintang and Cullen, 2001; The Angiosperm Phylogeny Group et al., 2016). This species is a protected wild plant classified as endangered wildlife grade II by the Ministry of the Environment due to the possibility of the extinction of the population and/or reduction in the number of individuals by climate change (Ministry of the Environment of Korea, 2014). A. tabularis is a potential horticultural plant as an ornamental species given its large leaves (approximately 1 m in diameter) and beautiful panicles (Belyaeva and Butenkova, 2016; Choi et al., 2016). It also has a long history of usage as a medicinal plant for diabetes (Liu et al., 2016). Due to biological conservation efforts and given the ecological importance of A. tabularis, genetic diversity analysis studies have been conducted using AFLP and isozymes (Ku et al., 2006; Lee, 2008).
To the best of our knowledge, no microsatellite markers have been developed thus far for A. tabularis for population studies. Population genetics research provides insight into conservation and management plans for rare and threatened species (Ottewell et al., 2016). To assess the genetic diversity of A. tabularis, we developed expressed sequence tag–simple sequence repeat (EST-SSR) markers. These have been used as a powerful molecular tool for genetic diversity studies of many plant species (Yan et al., 2016; Wang et al., 2017).

Materials and Methods

For the construction of the RNA library, the total RNA was extracted from leaves of individuals representing A. tabularis from three populations (Voucher No. NIBRVP0000655607) (Table 1). RNA was extracted using RNeasy kits, version 2.2 (Illumina, San Diego, CA, USA) following the manufacturer’s instructions, and was subsequently used for TruSeq cDNA library preparation and high-throughput Illumina HiSeq 100 bp paired-end de novo transcriptome sequencing. The analysis results reads were obtained and assembled into 102,884 unigenes with 7,476,378,742 read numbers. The de novo transcriptome assembly of these reads was performed using the short read assembling program Trinity r20140717 (Haas et al., 2013) with the default parameters. Microsatellites were detected using MIcroSAtellite (MISA) version 1.0.0 (Thiel et al., 2003) with thresholds of ten repeat units for dinucleotide and five repeat units for tri-, tetra-, penta-, and hexanucleotides. MISA identified 38,598 simple sequence repeats (SSRs), of which 96 loci were selected depending on (1) the number of SSR repeats, (2) a PCR product size of 150–500 bp, (3) an annealing temperature range of 55–60°C, and (4) a minimum GC content of 50% for further testing of A. tabularis. The primer sets were designed to flank the microsatellite-rich regions with a minimum of eight repeats using the Primer3 program (Rozen and Skaletsky, 1999).
We sampled 60 A. tabularis individuals from three wild populations (Table 1). All samples included in this study were collected in accordance with the requirements of permission and support from relevant authorities. To avoid collecting clones, we specified a distance of at least 2 m among individuals within each population. The voucher specimens were deposited in the National Institute of Biological Resources Herbarium (KB) and in the Herbarium of Hallym University (HHU) in Korea (Table 1). The locations of the sites have been withheld to prevent illegal collection. The utility of the 96 microsatellite markers was confirmed by PCR from each population of A. tabularis in a total volume 25 μL, containing 2.5 μL of 10× Ex Taq buffer (TaKaRa Bio Inc., Otsu, Japan), 2 μL of 2.5 mM dNTPs, 0.01 μM each of a forward and reverse primer, 0.1 μL of TaKaRa Ex Taq DNA polymerase (5 units/μL) (TaKaRa Bio Inc.), and 5–10 ng of template DNA. All PCRs were performed in a GeneAmp PCR System 9700 thermocycler (Applied Biosystems, Carlsbad, CA, USA) using the following program: initial denaturation at 98°C for 5 min followed by 30 cycles of denaturation at 95°C for 1 min, annealing at annealing at 59°C for 1 min with an extension at 72°C for 1.5 min, and a final extension step at 72°C for 10 min. Fluorescently labeled (HEX, FAM) PCR products were analyzed by an automated sequencer (ABI 3730XL) with the GeneScan 500 LIZ Size Standard (Applied Biosystems). Genotyping was performed using GeneMapper 3.7 (Applied Biosystems), and peaks were scored manually by visual inspections. Finally, we identified 26 polymorphic markers based on genotyping data, and functional annotations for these markers were performed on a subset of ESTs with BLASTX scores (E-value < 1 × 10−10) using the gene ontology database (Table 2). The genetic parameters of polymorphic loci were assessed by calculating the number of alleles (A), the observed heterozygosity (Ho), and the expected heterozygosity (He) using GenAlEx 6.5 (Peakall and Smouse, 2012). Degrees of deviation from the Hardy-Weinberg equilibrium (HWE) were estimated with ARLEQUIN 3.5 (Excoffier and Lischer, 2010).

Results and Discussion

The results of the genetic diversity of 26 polymorphic markers are shown in Table 3. Overall, the 26 microsatellite loci were polymorphic, with the number of alleles per locus ranging from one to five (average 2.218). The Ho and He values ranged from 0.000 to 0.950 and from 0.000 to 0.741, respectively (Table 3). Some polymorphic loci significantly deviated from HWE, though this was not consistent across populations.
This study describes the first assembly and characterization of the leaf transcriptome of A. tabularis using the Illumina paired-end sequencing method. Twenty-six polymorphic markers were successfully amplified, revealing polymorphisms in A. tabularis. This work can serve as a basis for further studies on the genetic diversity and structure of A. tabularis and can provide essential information for devising effective conservation strategies.

Acknowledgments

This research was supported by Grant No. NIBR201703201 from the National Institute of Biological Resources under the Ministry of Environment, Republic of Korea.

NOTES

Conflict of Interest
The authors declare that there are no conflicts of interest.

Table 1.
Voucher information for the Astilboides tabularis populations sampled in this study. Vouchers were deposited in the Herbarium of the National Institute of Biological Resources (KB) and in the Herbarium of Hallym University (HHU), Republic of Korea. To prevent illegal collection, we did not disclose the exact locations of the sites.
Population Locality No. Voucher No. (Herbarium)
Korea-1 Bonghwachi, Jeongseon 20 NIBRVP0000655607 (KB)
Korea-2 Geomyongso, Taebaek 20 KBY2017273 (HHU)
China Fusong Xian, Jilin Sheng 20 NIBRVP0000655609 (KB)

No., number of individuals sampled.

Table 2.
Characteristics of the 26 polymorphic microsatellite loci developed from Astilboides tabularis.
Locus Primer sequence (5′-3′) Repeat motif Allele size range (bp) GenBank accession No. Putative function [Organism] E-value
AT01 F: TCTGCCCTGATTGCACTTCA
R: TCTCTCCTCTGCGTCATTGC
(AG)6 220–224 MH476462 Not found -
AT02 F: CAGTGAGAGACAGTGGCCTT
R: ACGCCAAAACGATTGTGGTT
(AG)6 223–227 MH476463 Unnamed protein product, partial [Vitis vinifera] 1.00E-99
AT04 F: CAAGCCTGCCTTCATCTTGC
R: TGTTCCGAGGGATGTTGTGG
(AG)7 220–222 MH476464 Not found -
AT07 F: CAGAGGTGCCCACTTGGAAT
R:GCTGGGATGAGGTTTCACCA
(AG)7 227–229 MH476465 Not found -
AT09 F: ACGTGCGTGTTACTTGAGTG
R:GCAGAGCGAATTCGGAGAGA
(TC)7 218–230 MH476466 Not found -
AT12 F: GGAGGCTCTACTTCGTTGGG
R:CTAGCTAGCACCCACAGGC
(GA)7 231–237 MH476467 Conserved hypothetical protein [Ricinus communis] 9.00E-04
AT14 F: CAAGGACAATGGCACTTCCG
R:TCCTCCCTCGTCATCCAGTT
(AG)7 231–239 MH476468 Unnamed protein product, partial [Vitis vinifera] 2.00E-171
AT16 F: CATCTACCTCATCCCCACGC
R:TGGTTTTGTGTTGGGCAACT
(CT)7 228–238 MH476469 Cytochrome B5, n3,ATCB5-D,CB5-D [Theobroma cacao] 5.00E-56
AT24 F: TCGGCCTGTAGTGAGAGAGT
R:ACCCGCCTAAAATCACCCAA
(CT)7 246–252 MH939929 Not found -
AT25 F: TGAAGTGCAGCAACAGAATTTGA
R:AATGGGTCGGGTTTGGGAAA
(TA)6 236–258 MH476470 Not found -
AT29 F: AAGCCAACATTCTGCTTCGC
R:CACCACTTCGATCCAACCCA
(AG)8 249–255 MH939930 Not found -
AT30 F: CATGCGCTTGTTCCGTACAG
R:ACCCCGCTTTTTAGAGAGAGA
(CT)8 252–256 MH476471 Transcription factor SPATULA isoform X2 [Vitis vinifera] 2.00E-06
AT32 F: GCAACGACGTCGATTTCCG
R:TGCCCTAAAAATCACACTTCCG
(CT)7 255–269 MH476472 Not found -
AT33 F: GGCGTCTGGTCTTCGATCTT
R:CGTCGTGTGTAAGCAAGCAG
(TC)7 255–259 MH476473 Unnamed protein product, partial [Vitis vinifera] 0
AT43 F: AAACCATCTGAGCCCCTCAC
R:GATTGTAACGCGCCGAAGAC
(CT)8 262–276 MH939931 Uncharacterized protein TCM_015808 [Theobroma cacao] 1.00E-65
AT60 F: GAAGGTGTTGCTGATGAGCC
R:ATTGCAACAACTGACACCGC
(GCT)6 217–235 MH939932 Not found -
AT63 F: CCATCTCACCATTCTCGCGA
R:TCCATGGTTGCATTTGGGGA
(CGC)7 235–244 MH476474 RING-H2 finger protein ATL3 [Vitis vinifera] 9.00E-80
AT65 F: GTGTTTCGGGTCGTGAGTCT
R:GTTGAGGGACCTGACTGCAA
(GAT)5 231–240 MH476475 Not found -
AT66 F: TATCTCGCTAGGCCGGAGAT
R:CGAGGAAGATTCGAGGCCAA
(TGA)6 240–243 MH939933 Hypothetical protein PRUPE_2G009100 [Prunus persica] 2.00E-51
AT67 F: AATGAAGAGTCGTCGTCCCC
R:TCCCATGCTGCCCATTACTT
(CAC)6 239–251 MH476476 MLO-like protein 6 [Vitis vinifera] 5.00E-105
AT71 F: AGCCCTAACCGCCTTAATCG
R:CGCCCCAGAGAAGATCGAAA
(GCG)7 247–256 MH939934 Hypothetical protein B456_001G263100 [Gossypium raimondii] 5.00E-53
AT72 F: CGCGTCTCAAAATCGTCACC
R:CGGAAGTTTTACGGCCACAG
(GTT)6 242–254 MH476477 Uncharacterized protein LOC100257948 [Vitis vinifera] 8.00E-19
AT73 F: CTTCAGGGGAGTACGGAAGC
R:CTGGCTCAAGCTTTCGGAAC
(ACA)6 240–252 MH476478 Ethylene-responsive transcription factor 4-like [Nelumbo nucifera] 1.00E-28
AT74 F: GGCGTAGGGAGTACCACTTG
R:CCCCCTCCTCTCCTCTTCAT
(GAG)5 250–256 MH476479 Trihelix transcription factor ASIL2 [Cucumis melo] 2.00E-53
AT75 F: CGGCGAGGATTCAATGGAGA
R:TCAAAAGCCGACGATCGTCT
(TCC)6 251–254 MH939935 Hypothetical protein CICLE_v10032167mg [Citrus clementina] 4.00E-62
AT77 F: AGTGCACCTGGTGGAATGAG
R:AGCGGAGGCATTGTTCTGAA
(ACA)6 252–255 MH476480 Uncharacterized protein LOC100249661 [Vitis vinifera] 1.00E-144
Table 3.
Genetic diversity in three Astilboides tabularis populationsa based on the 26 newly developed polymorphic microsatellite markers (loci).
Korea-1 (n = 20) Korea-2 (n = 20) China (n = 20)

Locus A Ho Heb A Ho Heb A Ho Heb
AT01 1 0.000 0.000 1 0.000 0.000 3 0.100 0.265**
AT02 2 0.150 0.139 2 0.400 0.495 3 0.750 0.664
AT04 2 0.550 0.439 2 0.000 0.480** 2 0.167 0.498**
AT07 1 0.000 0.000 1 0.000 0.000 2 0.526 0.465
AT09 1 0.000 0.000 2 0.100 0.095 3 0.250 0.226
AT12 2 0.150 0.139 1 0.000 0.000 3 0.778 0.537
AT14 2 0.150 0.139 3 0.500 0.445** 2 0.053 0.229**
AT16 2 0.150 0.139 1 0.000 0.000 3 0.211 0.193
AT24 3 0.950 0.566** 3 0.750 0.636** 3 0.263 0.237
AT25 1 0.000 0.000 5 0.400 0.741** 2 0.059 0.057
AT29 2 1.000 0.500** 3 0.750 0.499* 3 0.684 0.608
AT30 1 0.000 0.000 2 0.000 0.495** 2 0.684 0.450*
AT32 1 0.000 0.000 3 0.850 0.611* 4 0.632 0.630
AT33 1 0.000 0.000 1 0.000 0.000 3 0.600 0.595
AT43 2 0.850 0.489** 1 0.000 0.000 3 0.111 0.285*
AT60 3 1.000 0.564** 2 0.550 0.499 4 0.737 0.560**
AT63 1 0.000 0.000 2 0.100 0.095 2 0.105 0.100
AT65 1 0.000 0.000 1 0.000 0.000 2 0.188 0.170
AT66 2 0.850 0.489** 1 0.000 0.000 1 0.000 0.000
AT67 2 0.053 0.051 1 0.000 0.000 4 0.222 0.398**
AT71 3 1.000 0.564** 3 0.400 0.586** 2 0.158 0.145
AT72 1 0.000 0.000 2 0.250 0.219 4 0.263 0.320
AT73 2 1.000 0.500** 3 0.944 0.628** 3 0.368 0.309
AT74 2 0.150 0.139 2 0.850 0.489** 3 0.556 0.475
AT75 2 0.850 0.489** 2 0.100 0.500** 2 0.526 0.432
AT77 2 0.100 0.095 2 0.600 0.420 1 0.000 0.000

n, number of individuals; A, number of alleles; Ho, observed heterozygosity; He, expected heterozygosity.

a Locality and voucher information are provided in Table 1.

b Significant deviation from HWE after correction for multiple tests (*p < 0.05 and **p < 0.01).

Literature Cited

Belyaeva, TN and Butenkova, AN. 2016. Seed productivity and leaf anatomy of Astilboides tabularis (Hemsl.) Engl.. International Journal of Pharma and Bio Sciences 7: 511-516.

Choi, JS. Jeong, JH and Lee, CH. 2016. The effects of environmental conditions and chemical treatments on seed germination in Astilboides tabularis (Hemsl) Engl. Korean Journal of Horticultural Science and Technology 34: 363-371.

Excoffier, L and Lischer, HEL. 2010. ARLEQUIN suite ver. 3.5: a new series of programs to perform population genetics analyses under Linux and Windows.. Molecular Ecology Resources 10: 564-567.
crossref pmid
Haas, BJ. Papanicolaou, A. Yassour, M. Grabherr, M. Blood, PD. Bowden, J. Couger, MB. Eccles, D. Li, B. Lieber, M. MacManes, MD. Ott, M. Orvis, J. Pochet, N. Strozzi, F. Weeks, N. Westerman, R. William, T. Dewey, CN. Henschel, R. LeDuc, RD. Friedman, N and Regev, A. 2013. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis.. Nature Protocols 8: 1494-1512.
crossref pmid pdf
Jintang, P and Cullen, J. 2001. Astilboides.. In Flora of China. Vol. 8. Brassicaceae through Saxifragaceae. Wu, Z-Y. Raven, PH (eds.), Science Press, Beijing and Missouri Botanical Garden Press, St. Louis, MO. Pp. 269-452.

Ku, Y. Oh, H. Shim, K. Kim, M and Lee, S. 2006. Growth characteristics, genetic diversity and conservation of endangered plants (I): the case of Astilboides tabularis, Euchresta japonica, Echinosophora koreensis and Lilium cernuum. National Institute of Environmental Research, Incheon. Pp. 60 (in Korean).

Lee, WK. 2008. Genetic variation on the endangered Astilboides tabularis and the rare Rodgersia podophylla of Saxifragaceae in Korea.. MS Thesis. Sungkyunkwan University; Suwon. 28 (in Korean).

Liu, Z. Zhai, J. Han, N and Yin, J. 2016. Assessment of anti-diabetic activity of the aqueous extract of leaves of Astilboides tabularis . Journal of Ethnopharmacology 194: 635-641.
crossref pmid
Ministry of the Environment of Korea. 2014. Korean Red List of Threatened Species. National Institute of Biological Resources, Incheon. Pp. 223-234 (in Korean).

Ottewell, KM. Bickerton, DC. Byrne, M and Lowe, AJ. 2016. Bridging the gap: a genetic assessment framework for population-level threatened plant conservation prioritization and decision-making.. Diversity and Distributions 22: 174-188.
crossref
Peakall, R and Smouse, PE. 2012. GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research—an update.. Bioinformatics 28: 2537-2539.
crossref pmid pmc pdf
Rozen, S and Skaletsky, H. 1999. Primer 3 on the WWW for general users and for biologist programmers. Methods in Molecular Biology 132: 365-386.

The Angiosperm Phylogeny Group. Chase, MW. Christenhusz, MJM. Fay, MF. Byng, JW. Judd, WS. Soltis, DE. Mabberley, DJ. Sennikov, AN. Soltis, PS and Stevens, PF. 2016. An update of the Angiosperm Phylogeny Group classification for the orders and families flowering plants: APG IV.. Botanical Journal of the Linnean Society 181: 1-20.
crossref pdf
Thiel, T. Michalek, W. Varshney, R and Graner, A. 2003. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theoretical and Applied Genetics 106: 411-422.
crossref pmid pdf
Wang, RR-C. Larson, SR and Jensen, KB. 2017. Differential transferability of EST-SSR primers developed from the diploid species Pseudoroegneria spicata, Thinopyrum bessarabicum, and Thinopyrum elongatum . Genome 60: 530-536.
crossref pmid
Yan, H. Zhang, Y. Zeng, B. Yin, G. Zhang, X. Ji, Y. Huang, L. Jiang, X. Liu, X. Peng, Y. Ma, X and Yan, Y. 2016. Genetic diversity and association of EST-SSR and SCoT markers with rust traits in Orchardgrass (Dactylis glomerata L.). Molecules 21: 66.
crossref pmid
Editorial Office
Korean Journal of Plant Taxonomy
Department of Life Sciences, Hallym University, Chuncheon 200-702, Korea
TEL: +82-33-248-2095   FAX: +82-33-256-3420    E-mail: kjpt1968@gmail.com
About |  Browse Articles |  Current Issue |  For Authors and Reviewers
Copyright © Korean Society of Plant Taxonomists. All rights reserved.